| p-value: | 1e-6 |
| log p-value: | -1.561e+01 |
| Information Content per bp: | 1.823 |
| Number of Target Sequences with motif | 1044.0 |
| Percentage of Target Sequences with motif | 9.76% |
| Number of Background Sequences with motif | 3297.9 |
| Percentage of Background Sequences with motif | 8.36% |
| Average Position of motif in Targets | 97.9 +/- 56.8bp |
| Average Position of motif in Background | 102.2 +/- 57.5bp |
| Strand Bias (log2 ratio + to - strand density) | -0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.07 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
POL010.1_DCE_S_III/Jaspar
| Match Rank: | 1 |
| Score: | 0.71 |
| Offset: | 4 |
| Orientation: | forward strand |
| Alignment: | TCCCTAGC- ----CAGCC |
|

|
|
PB0050.1_Osr1_1/Jaspar
| Match Rank: | 2 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----TCCCTAGC---- ATTTACAGTAGCAAAA |
|

|
|
PB0051.1_Osr2_1/Jaspar
| Match Rank: | 3 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----TCCCTAGC---- ATGTACAGTAGCAAAG |
|

|
|
PB0054.1_Rfx3_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.59 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TCCCTAGC---------- TGTGACCCTTAGCAACCGATTAA |
|

|
|
MA0056.1_MZF1_1-4/Jaspar
| Match Rank: | 5 |
| Score: | 0.58 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TCCCTAGC TCCCCA-- |
|

|
|
PB0055.1_Rfx4_1/Jaspar
| Match Rank: | 6 |
| Score: | 0.57 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TCCCTAGC------ TACCATAGCAACGGT |
|

|
|
PB0154.1_Osr1_2/Jaspar
| Match Rank: | 7 |
| Score: | 0.57 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----TCCCTAGC---- NNNTTAGGTAGCNTNT |
|

|
|
MA0154.1_EBF1/Jaspar
| Match Rank: | 8 |
| Score: | 0.56 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TCCCTAGC-- TCCCTTGGGT |
|

|
|
PB0155.1_Osr2_2/Jaspar
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----TCCCTAGC---- NNTGTAGGTAGCANNT |
|

|
|
POL013.1_MED-1/Jaspar
| Match Rank: | 10 |
| Score: | 0.56 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | TCCCTAGC --CGGAGC |
|

|
|